The OpenHelix Blog

Welcome to our Friday feature link collection: SNPpets. During the week we come across a lot of links and reads that we think are interesting, but don’t make it to a blog post. Here they are for your enjoyment…

• After brent_p’s holiday tweet, I expected this to come along. An entire blog entry in code. And a comment as well. Heh.  This really is the post title: catgcgccgccgtattaaaatgaatggtaatatgaagcgcgt [Mary]
• Agree–this does look good: @moorejh: http://vizbi.org/2011 looks interesting #infovis #infoviz #visualization #bioinformatics [Mary]
• Yep, we’ll soon know the genome of the Hobbit possibly. Wonder what the gene for hairy feet is, probably a regulatory region. [Trey]