Simple primer design tools on the web

ResearchBlogging.orgThere are a lot of really complex bioinformatics tools and databases out there. But so often in training situations people ask us for something that solves a problem that is rather small and simple by comparison to genotype frequencies in the human populations. Sometimes they just need primers for their experiments.

I know there are commercial tools out there, and if you have a favorite you can let us know in the comments. But one very simple and free tool that people can use for primer design is Primer3. We have had a tutorial in our subscription collection about Primer3 for a long time since people asked us so frequently for this.

You can often find the software for Primer3 integrated in analysis pipelines too. If you do a primer search with the in silico PCR tool on the UCSC Genome Browser you will get some Primer3 features output. And another group decided to create a tabbed interface for Primer3 to increase usability and make it a bit less daunting–Primer3Plus. But I always sort of liked the basic interface, because I could see all my options at once. However, I can see that the tabs make sense for some people.

The Primer3Plus team described their work in a paper in NAR. Their goals were to make it a bit less daunting for occasional users, but still keep the features that more advanced users need available. So instead of one long page, the pieces of Primer3 were tabbed: General Settings, Advanced Settings, Internal Oligo, Penalty Weights and Sequence Quality. They designed the features around the user scenarios of Detection, Cloning, Sequencing, Primer Checking, and Lists of primers. Their documentation explains their thoughts and the software functions around these as well.

Primer3 is a real workhorse for everyday tasks. And freely available to use or download–with appropriate citations, of course!

Primer3:
Steve Rozen and Helen J. Skaletsky (2000) Primer3 on the WWW for general users and for biologist programmers. In: Krawetz S, Misener S (eds) Bioinformatics Methods and Protocols: Methods in Molecular Biology. Humana Press, Totowa, NJ, pp 365-386 DOI: 10.1016/S0307-4412(00)00018-2

Primer3Plus:
Untergasser, A., Nijveen, H., Rao, X., Bisseling, T., Geurts, R., Leunissen, J.A. (2007). Primer3Plus, an enhanced web interface to Primer3. Nucleic Acids Research, 35(Web Server), W71-W74. DOI: 10.1093/nar/gkm306

3 thoughts on “Simple primer design tools on the web

  1. deer hp

    gtggaaaccg gcagtgaggc cacagccgac agctgcccaa aggcccccga gattgccaac
    agccacgtgg agtactcagt tcgctatcag tgtgacaaat actacaaact gcatgctgga
    gatggggtgt atacctttaa caataagcaa tggataaaca aggacattgg acagcaactc
    cctgaatgtg aagatgccag ctgcccagag ccccccaaga ttgaaaatgg ctacgtggag
    cactcgattc gcttccagtg caaaacctat cacaaactgc gctctgctgg agatggagtg
    tacaccttta acagtaagaa gcagtggata aataagaacg ttggacagca actccctgaa
    tgtgaggcag tgtgcgggaa gcccaagcac ccagtggacc aggtgcagag gatcatcggt
    ggctcgttgg atgccaaagg cagctttccc tggcaggcca agatggtctc tcaccataac
    ctcatctcgg gagccacgct catcaatgaa cgatggctcc tcaccacagc taaaaatctc
    tacctgggtc ataccagtga caaaaaagca aaggacatcg ctcctacttt aagactctat
    gtgggaaaga accagcctgt agaggtggag aaggtggttc tccatcctga ccactccaag
    gtagacatcg ggctcatcaa actcagacag aaagtacccg tcaatgaaaa agtaatgccc
    atctgcctac cttcgaaaga ctatgtggca gtgggtcgtg tgggttatgt gtctggctgg
    gggcgaaatg ccaacttcaa ctttacagag catctgaagt acatcatgct gcctgtggct
    gaccaagaca agtgtgtgga gcactacgag aacagcactg tgcctgaaaa taagacggat
    aagagccctg tgggggtgca gcccatactg aataagaaca ccttctgcgt cggcctatcc
    aagtaccagg aggacacctg ctacggtgat gccggcagcg ccctcgtcgt tcacgaccag
    gaagacgaca cctggtacgc ggctgggatc ctgagctttg acaagagctg tgccgtggct
    gagtatggtg tgtatgtgaa ggtgacctcc attctggact gggttcggaa aaccatcgct
    aacaactaa

  2. Mary

    Hello deer hp–um, is that a question? I ran that sequence at Primer3 and here are some primers:

    OLIGO start len tm gc% any 3′ seq
    LEFT PRIMER 643 20 59.96 55.00 3.00 0.00 catcctgaccactccaaggt
    RIGHT PRIMER 884 20 60.06 55.00 7.00 2.00 ggcacagtgctgttctcgta

    Of course, there’s more detail if you run it over on either Primer3 or Primer3 Plus.

Comments are closed.