Friday SNPpets

Welcome to our Friday feature link collection: SNPpets. During the week we come across a lot of links and reads that we think are interesting, but don’t make it to a blog post. Here they are for your enjoyment…

  • RT @mem_somerville: Just heard on BBC too, same language MT @dgmacarthur: Point-by-point dissection of that awful piece on “the sleep gene” http://bit.ly/rQmERH [Mary]
  • Heh: RT @jordanagilman: my children are going to look at my evolution notes and laugh. “what do you mean, you didn’t know what every part of the genome coded for!?” [Mary]
  • RT @SAGRudd: GWASdb: a database for human genetic variants identified by genome-wide association studies = #awesome #GWAS = http://bit.ly/voCgt9 [Mary]
  • A database for Autism genetic factors. RT @ResearchBlogs: Scientific Databases – or Filters? http://goo.gl/fb/jx1eC [Mary]
  • RT @thierrygosselin: Genomic toolboxes for conservation biologists http://t.co/GmkicOvL [Mary]
  • Ha ha ha! RT @edyong209:  Sci-writer loses it; tweets genome RT @carlzimmer TTGCCTATAGGGCGTGCAGCTTACCCAGGGCATCGAAACACCTCTGATGGCTGAAGGTATCGATGGCGCTATCGTTGCTGCACGCCC…