• RT @KevinADavies: The Last First Base — my final editorial @bioitworld — the highs and lows, 1s and 0s of the past 11 years! http://t.co/nFmyR3ngtk
• RT @BBC_Future: Craig Venter says we only know around 1% of what we’ll ultimately know about our genome. http://t.co/ayxMV4mSyC (nonUK)
• RT @sethmnookin: “Earlier headline suggested humans have same genome as western painted turtle. That is incorrect.” http://t.co/ouZQzIcr2L ht @edyong209
• RT @dgmacarthur: Flatley: rejected someone who wanted to be sequenced to show they had alien DNA. “We don’t have a good reference genome.” #UYG13
• RT @em_underwood: Powerful story by Ginny Hughes for Nat Geo: Could DNA Databases Curb Human Trafficking& http://t.co/Z7eXbJQjuJ  via @ngphenomena
• RT @BioInfo: TrioVis: a visualisation approach for filtering genomic variants of parent-child trios. http://t.co/5uogKAfNXy #bioinformatics
• RT @MishaAngrist: The next controversy in genetic testing: clinical data as trade secrets? http://t.co/svGOVHjD8S
• RT @hemedoc: Why are medical students still dissecting cadavers but not learning the tools to dissect genomic data? – @EricTopol
• Via G+: Drew Endy originally shared to Synthetic Biology (Discussion):Congrats to Linda for publishing her first survey of what tools people are actually using in synthetic biology. http://www.jbioleng.org/content/7/1/13/abstract
• RT @_inundata: The #xckd R package is finally out.  http://t.co/NoadYvECGp
  let the nerdiness ensue. #rstats http://t.co/sAeQNcbaeA
• RT @notSoJunkDNA: cc @denizkural RT “@vsbuffalo: Great article: “Short read alignment: an introduction” http://t.co/PpisZNclei HT: @jnfass”

Is this the future of genomics ? twitter.com/ElementoLab/st…

— Olivier Elemento (@ElementoLab) 4. Mai 2013

• RT @atulbutte: Get raw deidentified clinical trial #bigdata here & now! RT @ImmPortDB: NIAID release data 1400 subjects, 11 studies http://t.co/RnzMBHM89G
• RT @genetics_blog: BioBlend: automating pipeline analyses w/ Galaxy & CloudMan http://t.co/P394y0Nipm doc: http://t.co/iudgyRNaPT #bioinformatics #usegalaxy
• RT @erlichya: Sex (chromosomes), Lies, and GWAS catalog. http://t.co/xBi2oB3O5V interesting paper by Manolio and friends #AJHG $paywall
• RT @genomicslawyer: Reporting Fail: The Reidentification of Personal Genome Project Participants: http://t.co/KZ2DAf5bx4 HT @madprime
• RT @girlscientist: Hmmm. But nice post/summary. RT @ElementoLab: Vogelstein v. Lander, Round 1 http://t.co/sq5kikueHx
• RT @dgmacarthur: Robert Green (@genomes2people) responds to criticism of his @TheACMG incidental finding recs: http://t.co/HQwZq8ifvK
• RT @MedStu21: Great: BioBin: a bioinformatics tool for automating the binning of rare variants using publicly available biol… http://t.co/af2UHC2OlC

Ha, ha, too funny! RT @ryneches Inter-laboratory politics at the UC Davis Genome Center. twitter.com/ryneches/statu…

— Suganthi (@suganthibala) 9. Mai 2013

• RT @BioinfoTools: Some thoughts on science journal Nature offering statisticians to their authors: http://t.co/5jhJnEbGbS
• Ha ha ha! RT @dgmacarthur: @genomesunzipped @NeuroMinded Yes: every base is sacred, every base is great. When a base gets wasted Ewan gets quite irate.
• RT @carlzimmer: Here’s a paper title I’d like to see: “The Genome of the Silver Maple Is Like the Genomes of Every Other Frigging Maple, Except More Boring”
• But then this: RT @VinJLynch: @carlzimmer I’d like to see “White Oak Genome Provides Unique Insights into Bourbon”…
• RT @ensembl: Nice balanced article on the #ENCODE controversy. http://t.co/4uYc7QClO0
• RT @phidias51: Just figured out how @utopiadocs connects you w/other researchers. Click Altmetrics, see who tweeted the article, follow them.
• Snorf (about the 1000bullgenomes.com project) RT @phylogenomics: OMG @atulbutte we need to do all the microbiomes from these bulls – it would be the 1000bullshits project
• RT @marc_rr: The strategies which a class of students uses to annotate bacterial genomes with #bioinformatics and #biocuration: http://t.co/9yrk7vdBIm
• RT @phylogenomics: The Tree of Life:  The need for a phylogeny driven genomic encyclopedia of eukaryotes http://t.co/9offu8LA9M
• RT @_inundata: Dear every journal,
  1. Open a @GitHub org account.
  2. If authors have a repo for a paper, fork it after acceptance & link it to it.

• RT @bbglab: IGV 2.3 (Integrative Genomics Viewer) can export data to Gitools heat-maps. https://t.co/UAOCIkhZa6 http://t.co/XEcTvx9OIq
• RT @NESCent: Sign up for a course in genetic & genomic software! Apply by June10 for the GMOD Summer School, July19-23 in DurhamNC http://t.co/YE6PEPAFCe
• RT @MikeTaylor: Very positive steps by Nature Group towards ensuring that more of what they publish is good science. http://t.co/sEVgks7vf7
• RT @Chris_Evelo: Amen RT @ldtimmerman: @wilbanks One co-worker at that bioinformatics co once said, ‘Dude, biology is complicated.’ Yeah. #sagecon
• RT @GeneticLiteracy: Celebrate the coming of DNA Day (Apr 25) with @IEEESpectrum’s special report on the Genetic Revolution. http://t.co/njqTHAYLXj
• RT @whitehouseostp: #BigData is a Big Deal for Biomedical Research: http://t.co/XDfZz6IJKU
• RT @rafaelsidi: DistilBio: The Life Sciences Graph Search Engine http://t.co/rbjAXBgnmE
• RT @NatureBiotech: Zebrafish reference genome http://t.co/ZUGUw7GE1S and >10,000 gene mutant resource in Nature http://t.co/vfTAPwNeuO #NBTHighlight
• RT @nccomfort: #DNA Day blog post from the Wellcome, featuring letters from their Codebreakers exhibit: http://t.co/0FvhgKEWX7 #histsci
• RT @GenomeBiology: Ray Gosling remembers Rosalind Franklin ‘on top of her form’ http://t.co/2FhobqFKmP #DNADay #DNA60
• RT @jennomics: You know that feeling when the last big publication from your PhD work is finally out? Yep, feeling that right now. http://t.co/aKaX1UMjCQ
• Yay you! RT @schelhorn: Wow, I did not expect to win this #DNA60IFX Parental leave, had to code with babygirl literally bouncing in arms. I feel honoured, thank you [here's the contest result page: DNA60: A special bioinformatics challenge from Genome Biology: THE WINNERS!!!]

If you could change the DNA of your unborn child in ONE way, what would it be? via Human Face of Big Data twitter.com/antonioregalad…

— Antonio Regalado (@antonioregalado) 17. April 2013

• RT @HankGreelyLSJU: This week’s JAMA is on Genomic Medicine. Lots of stuff, much of interest (to me). http://t.co/vXrs6X9Z2I McGruie, McCullough, & Evans esp.
• RT @matthewherper: What Does This $14 Billion Merger Deal Mean For The Future Of DNA Sequencing? @Forbes http://t.co/nSq76L3iP9
• RT @NIHDirector: Just listened to Supreme Court arguments about gene patents — it was a science, business, and law smack down! Verdict in June? #NIH
• RT @DNApolicy: Links to the Myriad Supreme Court transcript and an argument summary here http://t.co/iR5ISYrbmO   #Myriad #SCOTUS
• RT @razibkhan: New App Prevents Icelanders from Sleeping With their Relatives http://t.co/xzu8VxoLku
• RT @michaelhoffman: New FAQ on how to use the @ENCODE_NIH data for browser users and data downloaders. http://t.co/NgdS07adhJ
• RT @ProfBootyPhD: Will I ever get tired of Mark Ptashne kicking “epigenetics” in the nuts? No. http://t.co/vQD0yjixVI
• RT @tharris: Best hashtag: #workingwithfrancis; would add @timhortons MT “@bffo: New #job WebDev Team Content Editor http://t.co/WalrwCfbZA #oicr”
• RT @sangerinstitute: We’re running an online survey  that is trying to capture public attitudes on the use of #genetic information. http://t.co/6CT4p58xzD

Yes.

Am I allowed to be offended when a job vacancy mail (for a professorship in Bioinformatics) starts with “Dear sirs”?

— Joke Reumers (@JokeReumers) 16. April 2013

• RT @gauravjain49: Ewan Birney`s current stand on #ENCODE findings http://t.co/vzEW0GSM1F BBC interview with Ewan Birney  @ENCODE_NIH @EncodeDCC @FakeEncode
• And check out the interesting discussion at the tweet link (@takluyver). RT @takluyver: The paper on my species name matching software has been published! http://t.co/IRsLrw4nAe (and it’s open access)
• RT @razibkhan: 10 Unusual Genetic Mutations in Humans http://t.co/bobhM5zI3k Good read
• Scientists–they are watching you: RT @carlzimmer: Here’s a free program for statistical power. Journalists, plug in values & hold feet to the fire! http://t.co/XRSbm6BYek via @Keith_Laws
• RT @NIHDirector: A so-so drug for rheumatoid arthritis worked wonders for kids with a rare fatal genetic disease #NIH http://1.usa.gov/RijXi2
• I hate when that happens. RT @PhilippBayer: New personal rule for #bioinformatics: “If something doesn’t work it’s because I’m an idiot”
• RT @zeusisdead: RT @figshare: “Send me your data – PDF is fine,” said no one ever (how to share your data effectively): http://t.co/fPO1PCKoIL
• RT @MarkHahnel: Nine simple ways to make it easier to (re)use your data: https://t.co/1AGp1QKCPy #opendata via @thePeerJ

! RT @edueyras: We’ve tried to capture in an image the diversity of methods to study splicing from RNA-Seq twitter.com/EduEyras/statu…

— Daniel MacArthur (@dgmacarthur) 9. April 2013

• RT @erlichya: Is ELSI over-hyped? http://t.co/2PmihiqfB1 #OA @GenomeMedicine IMHO paper could benefit from pre-1945 citations if you know what I mean.
• RT @DrKhouryCDC: Eight recommendations to transform  epidemiology for 21st century medicine & public health @NCIepi http://t.co/oBEXXKdXwG
• RT @genomicslawyer: My guest post at @LawATMultiverse on Mutant Discrimination: GINA, Genetics & How Professor Xavier is Breaking the Law http://t.co/z52nD7z3Gi
• RT @mitramith: Nice flowchart for quick reference. “@figshare: RNA-seq Workflows and Tools: http://t.co/fa3QjEax0U #statistics #bioinformatics”
• Via BBC: First beaver spotted at a Perthshire loch in 400 years is given a DNA test
• RT @SAGRudd: Platyfish genome provides insights into evolutionary adaptation & complex traits = #LooksNothingLikeAPlatypus @ http://t.co/THmJUklpUs
• RT @caseybergman: Hey tweeps headed to #DROS2013, please spread the word about @fly_papers as an easy way to keep up with new #drosophila papers in PubMed
• RT @cwvhogue: new post: Ten steps to accelerate your #bioinformatics lab with undergraduate trainees.
  http://t.co/7j4XOrIIUV
• RT @mbeisen: I saw a clip of @NeilShubin in upcoming “Your Inner Fish” – on @PBS in Spring 2014 http://t.co/gZISV6LM9Q – and it was amazing.
• RT @dgmacarthur: Rambling but important article from Ioannidis: http://t.co/VENExpBXWL If you want to do real science, learn from GWAS.
• RT @joe_pickrell: These authors seem to be completely astounded that they were able to replicate GWAS hits from @23science http://t.co/7WKJ1wZZKh

• RT @maikovich: I’ll give a talk about the ENCODE RNA dashboard at the Heidelberg Unseminars in Bioinformatics this evening: http://t.co/tcrYqU529I
• RT @genetics_blog: A new way to protect privacy in large-scale genome-wide association studies http://t.co/I59zf4TL4X
• RT @bioinfosm: and public databases MT: @nygenome #bioinformatics tools allow researchers @broadinstitute for tumor cell populations http://t.co/wY4TEJe65m
• RT @GenomeNathan: A (sincere) modest proposal on variant classification. http://t.co/Jbu0Q9GT3i #acmgmtg
• RT @IcahnInstitute: Video: Watch Jeff Hammerbacher of Mount Sinai’s Icahn Institute on Charlie Rose last night @CharlieRoseShow http://t.co/89jldANVvE
• RT @moorejh: CAACATATAGGCCTGCTAGCTTGAATATGAGTCTAATAATGAATATAGGCTATAATTTGCTAG http://t.co/dIzUQRFrCD #DNA #genomics #twitter HT @paul_sonnier
• RT @leilajamal: Great nutshell summary of ACMG incidental findings rpt from @rickilewis http://t.co/EAypTUQnnc via @sciam
• RT @nygenome: .@MountSinaiNYC’s @jdudley & @stanfordbmi’s Konrad Karczewski had their genomes sequenced for their textbook http://t.co/wFjrdUJlm0
• RT @neilfws: And lo, my first upload to slideshare for 4 1/2 years. “Version Control in Bioinformatics: Our Experience Using Git”: http://t.co/wHBCVy3wW4
• RT @mike_schatz: Can you assemble genomes, find mutations, and decode secret messages? Get ready for the #DNA60IFX challenge! http://t.co/jOGDkxgQho
• RT @JenLucPiquant: Synthetic Classification: The Evolution of Imaginary Animals  http://t.co/z4eBal77Hd
• via Google+: iPlant at a Glance: Five Years of Achievements | The Stem http://ow.ly/jyBjk

Related Tutorials:ENCODE Data at UCSC

• Um, how many genes? But a nice story of the outcome still. RT @TGen: .#CBS5 News covers @TGen patient #ShelbyValint’s evolution from wheelchair to dancing, thanks to genomic sequencing. http://t.co/jaZw9H3QCF
• RT @atulbutte: Millions unknowingly carry detectable rare gene mutations for high risk of preventable dzs: cancers, heart, more http://t.co/YWJm1Ejm1C
• RT @Rbaltman: Red wine and caffeine–two of my favorites, had a good week in SCIENCE.  http://t.co/naET3d67SR and http://t.co/x2LvynJbAE.
• RT @aztezcan: Father/Scientist Finds Gene Responsible for Daughter’s Unknown Syndrome: http://t.co/KvYIaqoskb http://t.co/kg8c8DgJiO via @sharethis
• RT @BioMickWatson: My new favourite sequence entry: http://t.co/nQCR6SgWFO
• RT @TheAtavism: Ha, via @neilfws , “NA” is an official gene symbol http://t.co/k5Om811X9d – trap for analyses in R where most missing data is set to NA
• RT @smallmultiples: Our new gene patent datavis for Cambia http://t.co/b44A8kL02g (beta). More at: http://t.co/XEibt9Qqhk #genepatents #datavis #bioinformatics
• RT @BioMickWatson: And “the alternative what it takes to be a bioinformatician” http://t.co/mFWP1UEbbd
• RT @matthewherper: A search engine for finding rare diseases. http://t.co/E6oRuK0jY8
• RT @konrad_jk: ICYMI: last week, our paper on in-depth functional analysis on indels came out in @genomeresearch http://t.co/pE4lSlksrv
• RT @DanGraur: A collection of emails on the subject of ENCODE and our demolition paper + 2 funny pictures http://t.co/IpFu83bsBb

Cool image we got this week of large DNA strands immobilised prior to optical mapping (image width=~250Kbp) twitter.com/drtkeane/statu…

— Thomas Keane (@drtkeane) 16. März 2013

• RT @emmecola: DNA tool kit goes live online http://t.co/oxojCDt58j
• RT @genomicslawyer: Hyperbolic, alarmist & paternalistic CNN op-ed by Art Caplan on consumer genetic testing: http://t.co/6fham9DpUI via @blaine_5
• RT @Genome10K: REMINDER: deadline for G10K conference registration is 04/05/13. limited space for conference & hotel. Register now. http://t.co/oFnxZyzvM7
• RT @WardPlunet: Havoc in biology’s most-used human cell line: Genome of HeLa cells sequenced for the first time http://t.co/VVpZmiwIiX
• RT @hrana: Blog: “From tumors to tapeworms: parasite’s genome points to new uses for cancer drugs” by Yevgeniy Grigoryev (N) http://t.co/f76HqEtzo2
• Giggle. My favorite was DuhOmics. RT @iddux: Some -omics words we’d like to see: http://t.co/r1U5glVXgr
• +10 RT @andrewsu: +1 MT @bffo: @StevenSalzberg1: congrats on the 2013 Benjamin Franklin Award! Interview with BioIT: http://t.co/xPlrx9xNBS #bioinformatics
• RT @mpreininger: New version of GenomeTV! http://t.co/3fpwqeLvaK
• Say what? RT @bio_insilico: I Gave My DNA to a Company in China so They Can Manufacture Genius Babies – Motherboard (bl… http://t.co/DBZ55cOa0Z #biotech #genomics

Nice overview of tools for RNA-seq transcript assembly, quantitation, & DE: seqanswers.com/forums/showpos… twitter.com/genetics_blog/…

— Stephen Turner (@genetics_blog) 13. März 2013